Inactive ASO (in vivo) sodium
Partner: MedChemexpress LLC
| MW: | N/A |
| Formula: | N/A |
| SMILES: | [CCTATAGGACTATCCAGGAA] |
| Purity: | 92.18 |
| Description: | Inactive ASO (in vivo) sodium is an inactive Antisense Oligonucleotide. ASO is a class of oligonucleotide molecules, usually composed of 20-30 bases, used to interfere with or regulate gene expression. Inactive ASO (in vivo) sodium is not targeted in the rodent genome and can be used as a negative control for Tofersen. Inactive ASO (in vivo) sodium contains thiophosphate skeleton modification and MOE modification. Cytosine in Inactive ASO (in vivo) is 5' methylcytosine. See References for the location of chemical modifications |
| Shipping Conditions: | Ship on cold packs |
| Usage: | Research Use Only |
Insight Biotechnology Ltd reserves the right to change pricing without notice
